[Shootout-list] f90 version of fasta
Simon Geard
simon@whiteowl.co.uk
Wed, 19 Jan 2005 22:39:16 +0000
This is a multi-part message in MIME format.
--------------010905070404050704000202
Content-Type: text/plain; charset=us-ascii; format=flowed
Content-Transfer-Encoding: 7bit
Attached is the f90 version of fasta translated from the lua program.
Simon
--------------010905070404050704000202
Content-Type: text/plain;
name="fasta.f90"
Content-Transfer-Encoding: 7bit
Content-Disposition: inline;
filename="fasta.f90"
! fasta implementation - translated from the lua program
! Simon Geard, 18/1/05
!
! Building info.
! ==============
!
! Linux - using the Intel Fortran90 compiler:
!
! ifort fasta.f90 -O3 -static-libcxa -o fasta
!
! Run
! ===
! fasta 1000
program fasta
implicit none
integer num, m
character(len=8) argv
logical, dimension(:), allocatable :: flags
integer, parameter :: IM = 139968
integer, parameter :: IA = 3877
integer, parameter :: IC = 29573
character(len=*), parameter :: alu = 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' // &
'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' // &
'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' // &
'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' // &
'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' // &
'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' // &
'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'
type pair
character(len=1) c
real*8 p
end type pair
type(pair), dimension(15) :: iub
type(pair), dimension(4) :: homosapiens
homosapiens = (/ pair('a', 0.3029549426680d0), &
pair('c', 0.1979883004921d0), &
pair('g', 0.1975473066391d0), &
pair('t', 0.3015094502008d0) /)
call makeCumulative(homosapiens)
iub = (/ pair('a', 0.270d0), &
pair('c', 0.125d0), &
pair('g', 0.125d0), &
pair('t', 0.270d0), &
pair('B', 0.02d0), &
pair('D', 0.02d0), &
pair('H', 0.02d0), &
pair('K', 0.02d0), &
pair('M', 0.02d0), &
pair('N', 0.02d0), &
pair('R', 0.02d0), &
pair('S', 0.02d0), &
pair('V', 0.02d0), &
pair('W', 0.02d0), &
pair('Y', 0.02d0) /)
call makeCumulative(iub)
call getarg(1,argv)
read(argv,*) num
call makeRepeatFasta('ONE','Homo sapiens alu',alu,num*2)
call makeRandomFasta('TWO','IUB ambiguity codes',iub,num*3)
call makeRandomFasta('THREE','Homo sapiens frequency',homosapiens,num*5)
contains
real*8 function getRandom (maxval)
real*8, intent(in) :: maxval
integer, save :: last = 42
last = mod(last * IA + IC, IM)
getRandom = maxval * last / IM
end function getRandom
subroutine makeCumulative(a)
type(pair), dimension(:), intent(inout) :: a
integer i
real*8 :: cp
cp = 0.0d0
do i=1,size(a)
cp = cp + a(i)%p
a(i)%p = cp
end do
end subroutine makeCumulative
character(len=1) function selectRandom(a)
type(pair), dimension(:), intent(inout) :: a
integer i
real*8 :: r
r = getRandom(1.0d0)
selectRandom = 'J'
do i=1,size(a)
if (r < a(i)%p) then
selectRandom = a(i)%c
return
end if
end do
end function selectRandom
subroutine makeRandomFasta(id,desc,a,n)
character(len=*), intent(in) :: id
character(len=*), intent(in) :: desc
type(pair), dimension(:), intent(inout) :: a
integer, intent(in) :: n
integer :: todo, i
integer, parameter :: length = 60
character(len=length) :: buff
write(*,'(4a)') '>',id,' ',desc
todo = n
do
if (todo <= 0) exit
if (todo < length) then
m = todo
else
m = length
end if
do i=1,m
buff(i:i) = selectRandom(a)
end do
write(*,'(a)') buff(1:m)
todo = todo - length
end do
write(*,'(a)') ''
end subroutine makeRandomFasta
subroutine makeRepeatFasta(id,desc,s,n)
character(len=*), intent(in) :: id
character(len=*), intent(in) :: desc
character(len=*), intent(in) :: s
integer, intent(in) :: n
integer :: todo, i, j, k, kn
integer, parameter :: length = 60
character(len=length) :: buff
intrinsic len
write(*,'(4a)') '>',id,' ',desc
todo = n; k = 1; kn = len(s)
do
if (todo <= 0) exit
if (todo < length) then
m = todo
else
m = length
end if
do j=1,m
if (k > kn) then
k = 1
endif
buff(j:j) = s(k:k)
k = k + 1
end do
write(*,'(a)') buff(1:m)
todo = todo - length
end do
end subroutine makeRepeatFasta
end program fasta
--------------010905070404050704000202--