[Shootout-list] Re: OCaml k-nucleotide

[Joel Hoffman]

Christophe TROESTLER wrote:

>On Sun, 27 Mar 2005, Christophe TROESTLER <del-con@tiscali.be> wrote:
>  
>
>>Would it be possible to have more information on why the OCaml
>>k-nucleotide is failing?  I can see that the output is not correct;
>>but it is on my machine, so I am a but puzzled...
>>    
>>
>
>BTW, the same is true for the Perl version.
>
>ChriS
>  
>

The Perl version fails in the case where THREE is the first reading 
frame in the file (I set the record separator to include a \n... doh.) I 
submitted a fixed version but it hasn't yet appeared.

I'm no OCaml expert, but it doesn't appear to ignore comments (lines 
starting with ;). Try it against this input:

 >THREE Homo sapiens frequency
;This is a test.
agagagacgatgaaaattaatcgtcaatacgctggcgaacactgagggggacccaatgctgcg